His⋯Asp Catalytic Dyad of Ribonuclease A: Structure and Function of the Wild-Type, D121N, and D121A Enzymes^†

Materials

Escherichia coli strain BL21(DE3) (F⁻ ompT r_B-m_B⁻)(37) was from Novagen (Madison, WI). Buffers (except Tris), cUMP, and IPTG were from Sigma Chemical (St. Louis, MO). Tris was from Fisher Scientific (Pittsburgh, PA). Poly(C) was from Midland Reagent (Midland, TX). UpA was synthesized by J. E. Thompson using methods published previously (38, 39). Growth media were from Difco (Detroit, MI) or, for 10-L growths, Marcor Development (Hackensack, NJ). DNA sequences were determined with the Sequenase Version 2.0 kit from U.S. Biochemicals (Cleveland, OH). DEAE Sephadex A-25 anion exchange resin, S-Sepharose cation exchange resin, and the mono-S FPLC cation exchange column were from Pharmacia LKB (Piscataway, NJ). Bacterial terrific broth [TB; (40)] contained (in 1 L) tryptone (12 g), yeast extract (24 g), glycerol (4 mL), KH₂PO₄ (2.3 g), and K₂HPO₄ (12.5 g).

Mutagenesis

Previously, we described the construction of a bovine pancreatic cDNA library, the cloning of the cDNA that codes for RNase A, and the efficient expression of this cDNA in Escherichia coli (41). Here, the codon for Asp121 was changed to one for an asparagine or alanine residue by oligonucleotide-mediated site-directed mutagenesis (42) using the oligonucleotides: 5′–ACTACTACACGCTAGCGTTAAAGTGGACT–3′ and 5′–ACTACTACACGCTAGCGGCAAAGTGGACT–3′, where the underlined bases differ from those in the wild-type cDNA. The GCT mismatch introduced a unique, translationally silent NheI site that was used to screen for mutated plasmids. The complete sequence of the cDNA that codes for each enzyme was determined. Plasmids that direct the expression of wild-type, D121N, and D121A RNase A were transformed into E. coli BL21(DE3).

Production of RNase A in E. coli

TB (0.20 L) containing ampicillin (200 μg/mL) was inoculated with a culture frozen in aqueous glycerol (30% w/v). After growth overnight at 37 °C, cells were collected by centrifugation and suspended in 0.20 L of fresh TB. This suspension was used to inoculate 10 L of TB containing ampicillin (200 μg/mL). When A = 4 at 600 nm, IPTG was added to a final concentration of 0.5 mM. The culture was grown for an additional 3.5 h.

Cells were collected by centrifugation, resuspended in 0.10 L of cold TE buffer, and lysed by passage through a French pressure cell twice. The lysate was centrifuged at 30000g for 30 min. The resulting pellet was washed with a cold solution (0.30 L) of deoxycholate (1 mg/mL), and centrifuged again. The pellet was suspended in 0.50 L of Tris-acetic acid buffer, pH 8.0, containing urea (9 M), acetic acid (50 mM), sarcosine (40 mM), and EDTA (1 mM). Sonication was used to aid dissolution. To reduce any disulfide bonds, dithiothreitol was added to a final concentration of 50 mM. After 1 h, the solution was passed through DEAE A-25 resin (25 g) that had been equilibrated with the above resuspension solution, and acetic acid (one tenth volume) was added to the effluent. The resulting solution was dialyzed exhaustively against 20 mM acetic acid. The dialysate was centrifuged, the supernatant was diluted to 1 L, and the pH raised to 8.1 by the addition of Tris base. Reduced glutatione and oxidized glutathione were then added to final concentrations of 2.3 mM and 0.8 mM, respectively. After 24 h the resulting solution was loaded on to an S-Sepharose cation exchange column (0.20 L). The column was washed with 1 L of 50 mM HEPES buffer, pH 7.9, and the adsorbed proteins were eluted with a linear gradient (0.50 L + 0.50 L) of NaCl (0 – 0.50 M). Fractions were pooled on the basis of A at 280 nm, and the pooled fractions were diluted with buffer to a protein concentration of <10 mg/mL. The resulting solution was loaded onto an HR10/10 mono-S cation exchange FPLC column (15 cm × 1.8 cm²) that had been equilibrated with 50 mM HEPES buffer, pH 7.9. The column was washed with 50 mM HEPES buffer, pH 7.9, and the adsorbed proteins were eluted with a linear gradient (50 mL + 50 mL) of NaCl (0 M – 0.50 M) in the same buffer. The proteins eluted between 0.09 M and 0.12 M NaCl. Fractions were again pooled on the basis of A at 280 nm, which was monitored continuously. To discourage deamination, the pH of the pooled fractions was lowered to 5.5 by the addition of 20 mM acetic acid. After exhaustive dialysis against water, the proteins were concentrated with an Amicon Centriprep-10® filter, passed through a 0.45-μm filter (Schleicher & Schuell; Keene, NH), and stored at 4 °C.

The purity of the protein preparation was assessed by SDS-PAGE and native PAGE. Based on the symmetry of A₂₈₀ peaks during cation exchange chromatography and the appearance of bands after electrophoresis through polyacrylamide gels, wild-type and the D121N variant were ≥99% pure and the D121A variant was ≥95% pure. The concentration of purified enzyme was determined by assuming that A = 0.72 at 277.5 nm for a 1.0 mg/mL solution (43). A 10-L growth typically yielded several hundred milligrams of purified enzyme.

Crystallization

Salt-free aqueous solutions of the D121N and D121A variants were lyophilized. Lyophilized D121N RNase A was dissolved in unbuffered water to a concentration of 60 mg/mL. Crystallization was performed in small siliconized tubes using the batch method. A solution (25 μL) of enzyme was mixed with an equal volume of 95% (v/v) 2-methyl-2,4-pentanediol (MPD) in 0.10 M MES buffer, pH 5.2, to give a final enzyme concentration of 30 mg/mL in 47.5% (v/v) MPD and 0.05 M MES buffer, pH 5.2. The pH of the buffer was determined prior to adding the MPD. Monoclinic crystals of D121N RNase A appeared after several months of incubation at 20 °C. These crystals belong to space group P2₁ with a = 30.52 Å, b = 38.40 Å, c = 53.31 Å, and β = 105.7°.

Lyophilized D121A RNase A was dissolved in unbuffered water to a concentration of 60 mg/mL. Crystallization was performed using the hanging drop method. Drops consisting of enzyme solution (1.5 μL), water (1.5 μL), and reservoir solution (3.0 μL) were suspended from siliconized coverslips over 0.50 mL of 2.5 M sodium acetate buffer, pH 5.3, containing saturating NaCl. Trigonal crystals of the D121A RNase A appeared within one day of incubation at 20 °C, and grew to a size of 0.5 mm × 0.5 mm × 1.0 mm after several days. These crystals belong to space group P3₂21 with a = b = 64.70 Å, c = 65.03 Å, and γ = 120.

X-Ray Diffraction Data Collection

All X-ray data were collected with a Siemens HI-STAR detector mounted on a Rigaku rotating anode operating at 50 kV, 90 mA and a 300 μm focal spot. The X-ray beam was collimated by double focusing mirrors. The crystal to detector distance was 12.0 cm. Data were obtained in 512 × 512 pixel format, processed with the program XDS (44, 45) and scaled using the program XSCALIBRE (G. Wesenberg and I. Rayment, unpublished results). The data set for D121N was 88% complete in the resolution range of 30 Å – 1.6 Å with an overall merging R-factor of 1.9%. The data set was 91% complete in the resolution range of 30 Å – 1.6 Å with an overall merging R-factor of 2.9%.

Structure Refinement

The starting model for the structure of D121N RNase A consisted of residues 2 – 124 of the wild-type enzyme (pdb entry 7rsa), stripped of all solvent molecules and sidechain atoms of residue 121. The model was subjected to ten cycles of least-squares refinement with the program TNT (46), yielding an initial R-factor of 23.4%. A difference fourier map (F_o – F_c) clearly showed the position of the sidechain atoms of Asn121. Manual adjustments to the model were performed by using the program FRODO (47). After several cycles of manual adjustments and least-squares refinement, the resolution was extended to 1.6 Å and water molecules were added to the model. The peak searching algorithm in TNT was used to place ordered water molecules. Water molecules with at least 1σ of 2F_o – F_c density, 3σ F_o - F_c density and within hydrogen bonding distance of the protein or of other water molecules were retained.

The structure of the D121N variant of RNase A was solved in the monoclinic space group P2₁ and contains only water molecules in the active site. Here, the D121N structure will be compared to that of phosphate-free wild-type RNase A, which was also crystallized from organic solvent in the P2₁ space group [pdb entry 7rsa; (48)]. The D121N structure will also be compared with the semisynthetic D121N RNase A analog (sD121N), which contains a sulfate ion in the active site and was crystallized from high salt in the trigonal space group P3₂21. The sD121N structure was solved to a resolution of 2.0 Å [pdb entry 3srn; (30)]. In a least-squares superposition, the mainchain atoms of D121N RNase A have an average RMS deviation of 0.15 Å from those of the wild-type enzyme and 0.75 Å from the sD121N analog.

The starting model for the structure of D121A RNase A consisted of residues 1 – 124 of wild-type RNase A (pdb entry 1rph), stripped of all solvent molecules and sidechain atoms of residue 121. The model was subjected to ten cycles of least-squares refinement with the program TNT (46), yielding an initial R-factor of 22.5%. A difference fourier map (F_o – F_c) clearly showed the position of the sidechain carbon of Ala121. Manual adjustments to the model were performed by using the program FRODO (47). After several cycles of manual adjustments and least-squares refinement, the resolution was extended to 1.6 Å and water molecules were added to the model. The peak searching algorithm in TNT was used to place ordered water molecules. Water molecules with at least 1σ 2F_o – F_c density, 3σ F_o – F_c density and within hydrogen bonding distance of the protein or of other water molecules were retained.

The structure of the D121A variant of RNase A was solved in the trigonal space group P3₂21 and contains the first example of an acetate ion in an RNase A active site. Here, the D121A structure will be compared to that of wild-type RNase A that was also crystallized from high salt in the P3₂21 space group and contains a bound sulfate in the active site [pdb entry 1rph; (49)]. The D121A structure will also be compared with that of the semisynthetic D121A RNase A analog (sD121A), which contains a sulfate ion in the active site and was crystallized from high salt in the P3₂21 space group. The sD121A structure was solved to a resolution of 2.0 Å [pdb entry 4srn; (30)]. In a least-squares superposition, the mainchain atoms of D121A RNase A have an average RMS deviation of 0.38 Å from those of the wild-type enzyme and 0.53 Å from the sD121A analog.

Enzyme Kinetics

Steady-state kinetic parameters for the cleavage of UpA and poly(C), and the hydrolysis of cUMP were determined by spectrophotometric assays. The catalytic dyad of RNase A most resembles the well-characterized catalytic triad of serine proteases during the hydrolysis reaction (Figure 1). For this reason, the steady-state kinetic parameters for the hydrolysis reaction were evaluated as a function of pH.

Assays were performed at 25 °C in a 0.10 M solution of the appropriate buffer, adjusted in pH with aqueous NaOH or HCl. Enough NaCl was added to each reaction to increase the ionic strength to I = 0.10 M, which was calculated based on the concentrations of buffer components and substrate. The buffer used for assays of the transphosphorylation of UpA (0.10 – 1.0 mM) and poly(C) (0.050 – 1.0 mM) was MES (pH 6.0). The buffers used for assays of the hydrolysis of cUMP were formic acid (pH 3.45, 4.00), acetic acid (4.48, 5.02), MES (5.53, 6.03), Bis-Tris (6.00, 7.02), BICINE (6.48, 7.97, 8.46), MOPS (6.94, 7.46), and AMPSO (9.00).

Assays were performed in a 1.0- or 0.2-cm cuvette with a Cary Model 3 spectrophotometer equipped with a Cary temperature controller. Substrate concentrations were determined by ultraviolet absorption using ε₂₆₀ = 24,600 M⁻¹cm⁻¹ at pH 7.0 for UpA (50) and ε₂₆₈ = 6200 M⁻¹cm⁻¹ at pH 7.8 for poly(C) (51), or by mass for cUMP. The concentrations of substrate in the assays ranged from K_m/5 to 5 × K_m. BSA (0.5 mg/mL) was added to the reactions containing poly(C). The cleavage of UpA was monitored at 286 nm using Δε = −755 M⁻¹cm⁻¹. The cleavage of poly(C) was monitored at 238 nm. The Δε at 250 nm, as calculated from the difference in molar absorptivity of the polymeric substrate and the mononucleotide cyclic phosphate product, has been reported to be 2380 M⁻¹cm⁻¹ at pH 6.2 (51). The Δε at 238 nm was determined to be 2792 M⁻¹cm⁻¹ by observing the change in absorption of a partially cleaved substrate at 250 nm and 238 nm. The hydrolysis of cUMP was monitored at either 282 nm or 293 nm. The values for the extinction coefficients determined for the hydrolysis of cUMP are listed in Table 3.

Kinetic Data Analysis

Data processing and nonlinear regression analysis were performed with the program MATHCAD (MathSoft; Cambridge, MA). Initial velocity data were weighted in proportion to the magnitude of each data point. The pH–rate profiles were fitted by using the logarithm of the kinetic constants. Reported errors were generated by the asymptotic variance – covariance matrix method. Because of strong product inhibition and a relatively small change in extinction coefficient, the initial velocities for the hydrolysis of cUMP were difficult to measure reliably. For this reason the steady-state kinetic parameters for this substrate were determined by using the integrated rate equation (52, 53) to fit the complete time-course of each hydrolysis reaction. The use of the integrated rate equation provided more accurate values for the steady-state kinetic parameters as well as values for K_p, the dissociation constant for the RNase A•3′-UMP complex. Each progress curve for the hydrolysis reaction was fitted to the integrated rate equation with the inclusion of product inhibition by an iterative procedure in which the kinetic parameters were varied by hand and the fit judged by eye. The value of k_cat was allowed to vary slightly from progress curve to progress curve to allow for small errors in enzyme concentration, with the values of K_m and K_p being held constant. The derivative of the functions so obtained was used to determine better fitting values for the initial velocities. These velocities were then used to obtain the kinetic parameters using the Michaelis-Menten equation. If the parameters so realized differed greatly from the initial values, the process was repeated until they differed little from the prior round. Generally, one or two rounds were sufficient.

Three-Dimensional Structures

RNase A was the third enzyme (after lysozyme and carboxypeptidase) whose structure was solved by X-ray diffraction analysis (56). Despite this early precedent (57), the crystalline structures reported here are the first for active-site variants. These structures show that replacing residue Asp121 of the His⋯Asp catalytic dyad with an asparagine or alanine residue does not affect the structure of RNase A beyond residue 121. Interpretations of function based on the identity of the active-site residues alone are thus justified.

The structure of RNase A is comprised of a twisted four-stranded, antiparallel β-sheet consisting of two long central β-strands, β2 and β3 (residues 71 – 92 and 94 – 110, respectively), flanked by two shorter β-strands, β1 and β4 (residues 41 – 48 and 118 – 123, respectively). Three helicies are found in RNase A: α1 at the N-terminus (residues 3 – 13), and α2 and α3 nearly perpendicular to and at either end of the β-sheet (residues 24 – 34 and 50 – 60, respectively). Nucleotide binding occurs in a deep cleft created by α1 and β3 (58). The bases of adjacent RNA nucleotides bind in three enzymic subsites referred to as B1, B2, and B3 (59). Catalysis occurs in the P1 subsite and results in the cleavage of the P–O^5′ bond specifically on the 3′-side of a pyrimidine nucleotide bound in the B1 subsite. Residues from the B1 subsite and P1 catalytic site compose the walls and floor of the groove. Gln11, Lys41, and Asn44 form one wall, and His119, Asp121, and Ala122 form the other. His12, Asn44, Thr45, and Phe120 form the floor of the B1 subsite. This discussion will focus on structural deviations observed in residues constituting the active site (Figures 2 and 3).

Gln11

The sidechain N_ε2 of Gln11 can donate a hydrogen bond to a phosphoryl oxygen in the active site. Site-directed mutagenesis studies in which Gln11 is replaced by an alanine, asparagine, and histidine residue have shown that the role of Gln11 is to prevent the nonproductive binding of substrate (41). In the structure of the RNase A•uridine 2′,3′-cyclic vanadate complex, N_ε2 of Gln11 forms a hydrogen bond with a nonbridging vanadyl oxygen, perhaps mimicking its interaction with the transition state (58, 60). The sidechain N_ε2 of Gln11 forms a hydrogen bond with a bridging phosphoryl oxygen in an RNase A•d(CpA) complex, and with a water molecule in an RNase A•3′-CMP complex (49).

In the wild-type monoclinic structure, N_ε2 of Gln11 forms a 3.0 Å hydrogen bond with a conserved water molecule in the active site, but O_ε1 forms no hydrogen bonds to surrounding water molecules (48). In the structure of D121N RNase A, the sidechain of Gln11 adopts a slightly different conformation. The sidechain N_ε2 of Gln11 forms a longer (3.4 Å) hydrogen bond with the conserved active-site water molecule, and O_ε1 forms a 2.9 Å hydrogen bond with a new water molecule. In the sD121N analog, N_ε2 of Gln11 adopts the same conformation as in wild-type RNase A, forming a 2.8 Å hydrogen bond with the conserved active-site water molecule.

In the wild-type trigonal structure, N_ε2 of Gln11 forms a 2.6 Å hydrogen bond with the conserved active-site water and a 3.0 Å hydrogen bond with a sulfate oxygen bound in the active site (49). The conserved active-site water is displaced by C₁ of an acetate ion in the D121A variant. The result is a small shift of N_ε2 away from the acetate (due to a 30° rotation around χ₃), with O_ε1 forming a hydrogen bond with a new water molecule. In the sD121A structure, N_ε2 of Gln11 forms a 2.8 Å hydrogen bond with the conserved active-site water molecule. But unlike in the wild-type enzyme, N_ε2 in the sD121A analog does not interact with the sulfate bound in the active site.

His12

In the classical mechanism for RNase A catalysis, N_ε2 of His12 acts as a base to abstract a proton from the 2′-hydroxyl group of RNA and thereby facilitate its attack on the phosphorous atom (33, 61). In all structures of RNase A in the pdb, His12 is found in the same position regardless of the crystallization conditions, solvent molecules, or ligand in the active site [(62); L. W. Schultz and R. T. Raines, unpublished results]. His12 forms a hydrogen bond between N_δ1 of its sidechain and the mainchain carbonyl of Thr45, and between N_ε2 and a water molecule or a ligand in the active site. The position of His12 in the D121N or D121A variants has not changed, overlapping quite well with His12 from the sD121N and sD121A structures. In the D121N structure, N_ε2 of His12 forms a 2.7 Å hydrogen bond with a water molecule in the active site. A similar 2.7 Å hydrogen bond is also found in the wild-type monoclinic structure. In the structure of the sD121N analog, N_ε2 of His12 forms a 2.5 Å bond with a sulfate oxygen in the active site. In the D121A structure, N_ε2 of His12 forms a 2.7 Å hydrogen bond with an acetate oxygen in the active site. This acetate oxygen is located in the same position as is the sulfate oxygen that forms a 2.8 Å hydrogen bond with N_ε2 in the wild-type trigonal structure. As in the sD121N analog, His12 of the sD121A analog forms a 2.5 Å hydrogen bond with a sulfate oxygen in the active site.

Lys41

The sidechain of Lys41 has been implicated in transition state stablization, contributing 10⁵-fold to catalysis (63). In addition, N_ζ of Lys41 has been shown to form a hydrogen bond with the 2′-oxygen of 3′-CMP and to a bridging vanadyl oxygen of uridine 2′,3′-cyclic vanadate (58, 49). In the D121N and D121A variants, the sidechain of Lys41 has clearly defined density and exists in a fully extended conformation. In the wild-type monoclinic and trigonal structures, N_ζ of Lys41 forms a hydrogen bond (2.6 Å and 2.7 Å, respectively) with O_δ1 of Asn44. The structures of the D121N and D121A variants have the same hydrogen bond (2.8 Å and 2.9 Å, respectively) between N_ζ of Lys41 and O_δ1 of Asn44, but N_ζ in the D121A enzyme makes an additional 2.5 Å hydrogen bond with a new water molecule in the active site. In the sD121N and sD121A analogs, N_ζ of Lys41 also forms a hydrogen bond (2.9 Å and 3.2 Å, respectively) to O_δ1 of Asn44. As in the D121A variant, however, N_ζ of Lys41 in the sD121N analog forms an additional 2.7 Å hydrogen bond with a water molecule in the active site. In the sD121A analog, N_ζ also forms a 2.8 Å hydrogen bond with O_ε1 of Gln11.

Residues 65 – 72

Residues 65 – 72 form a loop between α3 and β2. This loop resides near the active site and contains Lys66, which is implicated in the binding of a substrate phosphoryl group (59). Lys66 makes two interactions with Asp121 in the wild-type monoclinic RNase A structure: a 2.8 Å hydrogen bond from the mainchain N of Lys66 to O_δ2 of Asp121 and a 3.0 Å hydrogen bond from N_ζ of Lys66 to the mainchain O of Asp121. In the wild-type trigonal structure, the mainchain N of Lys66 also forms a 3.3 Å hydrogen bond to O_δ2 of Asp121, but N_ζ of Lys66 forms no interactions with the protein.

The hydrogen bond between the mainchain N of Lys66 and O_δ2 of Asp121 restricts conformational entropy by linking two parts of the native enzyme that are proximal in space but distal in sequence. ¹H-NMR data suggest that this hydrogen bond is especially strong (64). In X-ray diffraction analyses, the length of this hydrogen bond appears to rely on the crystallization conditions, being 2.8 – 2.9 Å in salt-free crystals and 2.9 – 3.3 Å in crystals containing salt.

Movement of the loop containing residues 65 – 72 away from the active site has been proposed to be a major contributor to the reduced activity of the sD121N and sD121A analogs (30). The mainchain atoms of residues 65 – 72 in the trigonal sD121N structure have an average shift of 0.76 Å away from the wild-type mainchain. In contrast, the same atoms in the monoclinic D121N structure have an average shift of 0.45 Å away from the wild-type mainchain, suggesting that the crystallization conditions and not the amino acid substitution are responsible for the larger shift.

Other significant differences exist between the D121N and sD121N structures (Figure 3A). The hydrogen bond between the mainchain N of Lys66 and O_δ1 of Asn121 is 2.9 Å in the D121N variant, but 3.2 Å in the sD121N analog. The sidechain N_ζ of Lys66 forms a 3.3 Å hydrogen bond with the mainchain O of Asn121 in the D121N variant, but a 3.5 Å hydrogen bond with O_δ1 of Asn121 in the sD121N analog. Semisynthetic F120L and F120Y analogs of RNase A in the trigonal form also form hydrogen bonds between N_ζ of Lys66 and O_δ1 of Asp 121, but neither forms a hydrogen bond with the mainchain O of Asp121 (65). Another difference is more dramatic, as it involves the flipping of the Lys66 – Asn67 peptide bond. The 㗕,Ψ angles for Lys66 and Asn67 for the wild-type RNase A (−56°,−35° and −85°,1°) and the D121N variant (−55°,−39° and −82°,−5°) are similar, but those for the sD121N analog (−84°,83° and 166°,−26°) differ. In the sD121N structure, a water molecule occupies the position of the mainchain O in the D121N structure. This water molecule in the sD121N structure is only 2.1 Å (which is an unrealistic distance) from the mainchain N of Asn67. We therefore suspect that the discrepancy between the location of residues 65 – 72 in the D121N and sD121N structures is largely due to an error in electron density map interpretation.

Residues 65 – 72 in D121A RNase A are almost identical in structure to residues 65 – 72 in the sD121A analog. The loss of the hydrogen bond between the sidechain of residue 121 and the mainchain N of Lys66 has caused the mainchain atoms in residues 65 – 72 in both structures to move away from the wild-type mainchain by an average 0.7 Å. Moreover, the Lys66 sidechain forms no hydrogen bonds to the protein in either structure. The absence of this hydrogen bond is, however, not uncommon [pdb entries 1lsq and 1rnc; (66, 67)]. Although the Asp121 sidechain to Lys66 mainchain hydrogen bond appears to be important in stabilizing the structure of residues 65 – 72, it is unlikely that hydrogen bonds to the sidechain of Lys66 play a significant role in that stabilization.

His119

In the classical mechanism of RNase A catalysis (Figure 1), His119 acts as a general acid by donating a proton to the 5″-oxygen to facilitate its displacement (33, 61). The sidechain of His119 has been shown to occupy two distinct positions, denoted as A and B, which are related by a rotation around χ₁ to dihedral angles of approximately 159° and −60°, respectively, and a concurrent rotation around χ₂ of 180° (68, 69). The active-site histidine residue in carbonic anhydrase II undergoes a similar rotation (70). There has been considerable debate as to which position of His119 in RNase A is catalytically relevant because the imidazole nitrogens have access to the active site in both orientations (30). It has also been argued that His119 is in position A during catalysis of transphosphorylation and in position B during catalysis of hydrolysis (69). In position A, N_ε2 of His119 forms a hydrogen bond with O_δ1 of Asp121, which directs N_δ1 of His119 toward the active site where it can form a hydrogen bond with a ligand (49). In the absence of a ligand, N_δ1 of His119 forms no apparent hydrogen bonds to water molecules (48). In the RNase A•3′-CMP complex, the sidechain of His119 is in position B, bringing N_ε2 within 3 Å of a nonbridging phosphoryl oxygen of 3′-CMP. In position B, N_δ1 of His119 is distal from the active site. In the crystalline RNase A•d(CpA) complex, the B2 subsite is occupied by adenine and the His119 sidechain is in position A (49). If the His119 sidechain were in position B, the imidazole ring would be in direct contact with the purine base and would create a steric clash (L.W. Schultz and R.T. Raines, unpublished results). It is therefore unlikely that His119 catalyzes RNA transphosphorylation reactions from position B.

The sidechain of His119 occupies position A in the D121N structure and overlaps with His119 in the wild-type structure almost exactly, with χ₁ = 160°. The sidechain N_ε2 of His119 forms a 2.6 Å hydrogen bond with N_δ2 of Asn121, and N_δ1 forms no hydrogen bonds. Similarly, the sidechain of His119 occupies position A in the D121A structure but has shifted toward the active site by a 15° rotation about χ₁ = 175°. In the absence of a hydrogen-bonding sidechain at residue 121, N_ε2 of His119 forms no hydrogen bonds, and N_δ1 of His119 forms a 2.5 Å hydrogen bond with the acetate ion in the active site. In the sD121A (χ₁ = −50°) and sD121N (χ₁ = −49°) analogs, the sidechain of His119 occupies position B. Others have concluded that in the absence of a hydrogen bond with the sidechain of Asp121, His119 would prefer position B over position A (30). We too expected a priori that replacement of Asp121 would shift the B⇄A equilibrium in favor of position B because of the loss of the favorable His⋯Asp interaction. Yet in the structures of crystalline D121N RNase A and D121A RNase A, His119 is in position A (Figures 2 and 3). It appears that the position of His119 is more dependent on crystallization conditions than on the identity of residue 121. Similarly, the position of His119 has been shown to depend on the pH (65) and ionic strength (62) of the crystallization solution. Finally, unlike in serine hydrolases (71), C_ε1 of His119 is not proximal to a mainchain O in either position A or position B. (Likewise, C_ε1 of His12 is not near a mainchain O.)

Asn121

At a resolution of 1.6 Å, it is impossible to distinguish N_δ2 and O_δ1 in the sidechain of Asn121. It is, however, possible to distinguish these atoms based on their hydrogen bonding schemes. In our model, O_δ1 of Asn121 occupies a position similar to that of O_δ2 in wild-type RNase A, forming a 2.9 Å hydrogen bond with the mainchain N of Lys66. This orientation is sensical because it is unlikely that N_δ2 of Asn121 could be in close proximity to a mainchain nitrogen. This orientation places N_δ2 of Asn121 near N_ε2 of His119. At pH 5.3 (which is the pH of the crystallization buffer), N_ε2 of His119 should be protonated, thereby rendering its interaction with the Asn121 sidechain unfavorable. But, the crystals of D121N RNase A were grown in MPD, a less polar solvent than water. Accordingly, the pK_a of His119 in the crystal is likely to be less than in water. We therefore propose that His119 is in the neutral imidazole state in which N_δ1 is protonated, and that N_ε2 forms a 2.6 Å hydrogen bond with the sidechain of Asn121.

A water molecule forms a bridging hydrogen bond between N_δ2 of Asn121 and the mainchain N of Asn67. The N_δ2 – water hydrogen bond distance is 3.1 Å with an N_δ2 – H – O angle of 120°. This water molecule, which is conserved in several RNase A structures, could stabilize the conformation of residues 65 – 72 by linking them to residue 121. In the sD121N analog, the water molecule has moved significantly, forming a long hydrogen bond with the mainchain N of Asn67 and perhaps resulting in a shift of the residues 65 – 72 away from the active site. Still, the sidechains of Asn121 in the D121N and sD121N structures overlap almost exactly (Figure 3A).

Ala121

The mainchain near residue 121 in the D121A variant remains in the same conformation as in the trigonal wild-type structure. The sidechain C_β of Ala121 overlaps directly with C_β of Asp121 in the wild-type RNase structure. In the D121A variant, a water molecule takes the place of O_δ2 of Asp121 and forms a 3.2 Å hydrogen bond with the mainchain N of Lys66. This water molecule is absent from the sD121A structure. In addition, the conserved water molecule that forms a bridging hydrogen bond between O_δ1 of Asp121 and the mainchain N of Asn67 in the wild-type enzyme is missing in the D121A and sD121A structures.

Catalysis by D121N RNase A and D121A RNase A

The effect of replacing Asp121 on k_cat/K_m and k_cat is small, but significant (Tables 2 – 4). Substitution with an asparagine residue decreases the rate constants for transphosphorylation by 10¹-fold and those for hydrolysis by 10^0.5-fold (Table 2). Substitution with an alanine residue decreases the rate constants for transphosphorylation by 10²-fold and those for hydrolysis by 10¹-fold (Tables 2 – 4). The differential effects on transphosphorylation and hydrolysis are still greater than these values suggest because a chemical step does not limit the rate of cleavage of UpA or poly(C) (72). We conclude that the contribution of Asp121 to transphosphorylation is greater than that to hydrolysis.

The small contribution of Asp121 to catalysis belies the importance of the hydrogen bond between His119 and Asp121. This contribution is similar to that observed in an analogous study on the structure and function of phosphatidylinositol-specific phospholipase C (73). Yet, a similar His⋯Asp dyad has been proposed to form a low-barrier hydrogen bond of extraordinary strength during catalysis by the protease chymotrypsin (74, 75), though this interpretation is controversial (76). One criterion for such a bond is an ¹H chemical shift of 17 – 20 ppm (77). The ¹H chemical shift of N_ε2H of His119 appears at a much higher field, <12 ppm (J. L. Markley, personal commun.). By this criterion, the His⋯Asp dyad of RNase A does not have a low-barrier hydrogen bond. In theory, the His⋯Asn dyad of D121N RNase A could also form a low-barrier hydrogen bond. Another criterion for such a bond is that it arise from acids with matched pK_a values (79). The pK_a values of acetamide [15.1; (80)] and imidazole [14.2; (81)], which are reasonable models for the sidechains of His119 and Asn121, respectively, are indeed similar. The existence of a low-barrier hydrogen bond would, however, require that the sidechain of His119 be in its neutral imidazole form. pH–rate profiles for catalysis by D121N RNase A (Figures 4 – 6) and 1H NMR titrations of His119 in the D121N variant (54) indicate that His119 titrates between its imidazole and imidazolium forms with a pK_a value similar to that of His119 in wild-type RNase A. These data deny the existence of a low-barrier hydrogen bond in the His⋯Asn dyad.

The kinetics of catalysis by D121N RNase A and D121A RNase A illuminate mechanistic aspects of the B⇄A equilibrium of His119. A Coulombic interaction, like that between a cationic histidine sidechain and an anionic aspartate sidechain, has a long range. In contrast, a hydrogen bond, like that between a histidine sidechain and an aspartate or asparagine sidechain, has a short range. Dispersion interaction between a histidine sidechain and an alanine sidechain are insignificant at distance beyond van der Waals radii. We find that RNase A variants with an aspartate, asparagine, or alanine residue in position 121 have different abilities to catalyze the hydrolysis reaction (Tables 3 and 4). We therefore conclude that His119 is likely to be proximal to residue 121 during catalysis of hydrolysis, and that hydrolysis can occur with His119 in position A.

pH-Dependence of Catalysis

The overall shape of the pH–rate profiles for catalysis by RNase A can be interpreted by using a model in which the only important protonation states are those of the two active-site histidine residues, which act in concert during catalysis [Figure 1; (82)]. Accordingly, log–log plots of the pH–rate profiles for k_cat/K_m and k_cat are expected to be bell-shaped with slopes approaching unity. The k_cat/K_m profiles that have been reported are indeed bell-shaped, but the shape of the k_cat profiles varies with the substrate (83-86). In general, workers who have used cCMP as the substrate have found that the slope = 1 for the acidic leg of the k_cat profiles; but those who have used cUMP have found that the slope < 1. The large values of K_m and strong product inhibition observed for the hydrolysis step at high pH make the basic leg difficult to characterize. These factors are likely to be the cause of the discrepant values reported for k_cat at high pH (83).

Our data on the pH-dependence of k_cat/K_m for the hydrolysis of cUMP agree with those of previous studies. [For a review, see: (87).] Our data on the pH-dependence of k_cat for the hydrolysis of cUMP are most similar to those of workers who, like us, accounted for product inhibition by using the integrated rate equation (86). This approach yields a slope near one at values of pH < 4.5, as well as higher values of k_cat and K_m at values of pH > 7 than are reported by others (84, 85).

Values of pK_a for the two histidine residues of wild-type RNase A can be derived from the k_cat/K_m profile (Table 4). The values agree well with results from NMR spectroscopy (88-91, 54). Differences for any given pK_a value are within error, especially when recalling that when two pK_a’s have similar values, the average value is much better determined from pH–rate profiles than are the individual values (92). The pK_a values of the D121N and D121A enzymes that are derived from pH–rate profiles (Table 4) do not deviate significantly from those of wild-type RNase A, at least at I = 0.10 M.

Role of Asp121 in Catalysis

pH–rate profiles for catalysis by D121N RNase A are similar to those for catalysis by the wild-type enzyme (Figures 4 – 6). This similarity suggests that the same titratable groups are participating in catalysis and that these groups have similar pK_a values. Yet in the structure of D121N RNase A, N_δ2 rather than O_δ1 of Asn121 is oriented toward His119. This orientation appears to stabilize a neutral form of the imidazolyl sidechain in which N_ε2 is unprotonated and N_δ1 is protonated. This tautomer of His119 is likely to be ineffective, either as an acid during the transphosphorylation reaction or as a base during the hydrolysis reaction. The major role of Asp121 thus appears to be to orient the proper tautomer of His119 for catalysis. This role is similar to that assigned to the aspartate residue in the catalytic triad of trypsin (26). In the D121A enzyme, Ala121 cannot interact with the imidazolyl group of His119. Yet, D121N RNase A is a better catalyst than is D121A RNase A (Tables 2 – 4). Thus, the His119⋯Asn121 interaction observed in the crystalline D121N enzyme (Figures 2 and 3) is unlikely to exist in solution. Rather, Asn121 is likely to move such that His119 can effect catalysis.

Conclusions

Replacing Asp121, a residue that is conserved in pancreatic ribonucleases, with an asparagine or alanine residue has no effect on the overall three-dimensional structure of RNase A. Replacing Asp121 decreases the rate of transphosphorylation by ≤10²-fold and the rate of hydrolysis by ≤10¹-fold. Thus, Asp121 of RNase A makes a significant but not a substantial contribution to catalysis. The likely role of Asp121 is simply to position the proper tautomer of His119, which Asn121 in the crystalline D121N enzyme fails to do. We speculate that the role of Asp121 in catalysis alone is unlikely to warrant its complete conservation in pancreatic ribonucleases (54).