B Lymphocytes Producing Demyelinating Autoantibodies: Development and Function in Gene-targeted Transgenic Mice

Construction of the Targeting Vector.

A 1.7-kb genomic region containing a rearranged V_HDJ_H gene (designated Th gene) was subcloned from hybridoma clone 8.18-C5 (18) and ligated to a PGK-neo gene in opposite transcriptional orientation. The Th gene spanning from an EcoRI site 1.1 kb upstream of the ATG codon to a BamHI site 160 bp downstream of J_H2 had been tested previously for functional expression by transfection into the myeloma line X63-Ag8.6.5.3 (not shown). 5′ and 3′ homologous sequences were derived from a cosmid clone isolated from an ES cell genomic library (a generous gift of S. Mudgett and R. Jaenisch, Whitehead Institute for Bio medical Research, Department of Biology, Cambridge, MA). The cosmid was reduced in size so that the J_H cluster was flanked by a 12-kb region upstream and a 1-kb sequence downstream of J_H4 including the H chain enhancer. The DQ52/J_H1–4 region was then deleted and replaced by the neo-Th gene cassette. The final targeting construct (see Fig. 1) was linearized at a unique NotI site and used for transfection.

Homologous Recombination in ES Cells.

ES cells of the R1 line (22) were transfected with the NotI-linearized targeting vector and selected with G418 as described (23). Southern blot analysis was performed with SacI-digested ES cell DNA and hybridized to a 0.8-kb ³²P-labeled external probe (see Fig. 1, probe 0.8E_H). We obtained 4 correctly targeted clones out of 320 G418-resistant ES cell clones and confirmed the mutation by sequencing of PCR-amplified DNA. Two of these positive clones were injected into C57Bl/6 blastocysts and reimplanted into pseudopregnant hosts. Both clones yielded germline-transmitting chimeras. These chimeric mice were crossed with C57Bl/6, and agouti offspring were screened for the Th mutation by Southern blot as above.

Flow Cytometry of Lymphocytes.

Single cell suspensions were prepared from spleen, LNs, peritoneal cells, and bone marrow from 6–8-wk-old mice and processed. Red blood cells were lysed by incubation in 0.165 M NH₄Cl for 10 min. Cells were washed with PBS/1% FCS and stained with the following Ab conjugates: anti–IgM^a-FITC (clone DS-1; PharMingen, San Diego, CA); anti–IgM^b-BIOTIN (clone AF6-78; PharMingen); anti–CD43-FITC (clone S7; PharMingen); anti–B220-PE (PharMingen); anti–CD5-FITC (clone 53-7.3; PharMingen); anti-IgD (Nordic Immunology Labs, Tilburg, The Netherlands); and 8.18-C5 idiotype–specific Ab (24). Biotinamidocaproate-N-hydroxysuccinimide ester (Sigma Chemical Co., Munich, Germany) was used for biotin labeling of recombinant truncated rat MOG (25), which was applied in a 1:500 dilution for staining. Biotin conjugates were developed with streptavidin-PE (Becton Dickinson, San Jose, CA), and the 8.18-C5 idiotype–specific Ab was detected with Cy3-labeled anti–rabbit Ig Ab (Jackson ImmunoResearch Labs, West Grove, PA). After excluding dead cells by staining with propidium iodide, cells were analyzed with a FACScan^® (Becton Dickinson).

Serum ELISA and Western Blot Analysis.

Peripheral blood of mice was taken by tail bleeding, and after coagulation at 4°C, serum was obtained by centrifugation. For ELISA, 96-well vinyl assay plates (Costar Corp., Cambridge, MA) were coated with one of the following reagents at a concentration of 10 μg/ml in PBS/ 0.02% NaN₃: goat anti–mouse IgM (Southern Biotechnology Associates, Inc., Birmingham, AL); recombinant MOG (rMOG); and synthetic peptides spanning the extracellular domain of MOG. The expression and purification of rat rMOG were described previously as well as the composition of the synthetic MOG-peptides (25, 26). After blocking with 1% BSA, the assay plates were incubated with serial dilutions of mouse serum. Specific binding was detected with alkaline phosphatase (AP)-conjugated goat anti–mouse IgG (Southern Biotechnology Associates, Inc.), biotinylated anti-IgM^a and anti-IgM^b (PharMingen), and streptavidin-coupled AP (Amersham International, Buckinghamshire, UK) as a secondary reagent. p-Nitrophenyl phosphate (Sigma Chemical Co.) was used as a substrate for the AP-catalyzed reaction. The absorbance at 405 nm was read on an ELISA reader (MR-4000; Dynex Technologies, Denkendorf, Germany). For Western blot analysis, 20 μg of mouse brain–extracted proteins and rMOG were run on a 12.5% polyacrylamide gel and transferred to a nitrocellulose membrane (Hybond-ECL; Amersham International). The blot was probed with 1:500 diluted mouse serum or with the 8.18-C5 mAb in a concentration of 4 μg/ml. Specific binding was detected with peroxidase-conjugated goat anti–mouse Ig (1:4,000; Amersham International) applying the ECL system (Amersham International).

Cloning and Sequence Analysis of H Chain Sequences.

Spleens were taken from naive and rMOG-immunized mice and immediately frozen in liquid nitrogen. Total RNA was extracted with Trissolv reagent (GIBCO BRL, Eggenstein, Germany) according to the manufacturer's instructions. cDNAs were synthesized from 10 μg freshly dissolved total RNA per cDNA reaction using Superscript reverse transcriptase (GIBCO BRL) with oligo(dT) as a primer. The resulting cDNA was diluted to 100 μl, and 2 μl of each sample (corresponding to 200 ng of total RNA) was used for PCR amplification with the following primers: 5′ primer, 8.18FR1: CGGGATCCACTCCCAGGTTCAGCTGC, and a 3′ located Cγ primer (27). PCR reactions were carried out using the following conditions: 94°C for 5 min (1 cycle); 94°C for 60 s, 60°C for 60 s, 72°C for 120 s (30 cycles), followed by a final step of 10 min at 72°C. The PCR products were purified from an ethidium bromide–stained agarose gel and cloned into pBluescript (Stratagene Inc., Heidelberg, Germany) using the restriction endonuclease BamHI. Several transformed bacterial clones were analyzed by DNA sequencing; the sequencing reaction was performed by MediGene (Martinsried, Germany).

Immunization of Mice and Evaluation of EAE.

C57Bl/6 mice were obtained from the animal facility at the Max-Planck-Institut für Biochemie, and SJL mice were purchased from Charles River WIGA GmbH (Sulzfeld, Germany). Transgenic F1 (129/Sv × Bl/6) progeny of chimeric mice were bred onto the C57Bl/6 and the SJL strain to perform EAE experiments. Mice of the fourth backcross to SJL were injected with an emulsion of 200 μg proteolipid protein (PLP) 139–154 (28) in CFA (GIBCO BRL) supplemented with 4 mg/ml inactivated Mycobacterium tuberculosis (H37 RA; Difco Laboratories, Inc., Detroit, MI) in the flanks on both sides and the tail base. The animals received an additional intraperitoneal injection of 200 ng pertussis toxin (List Biological Labs, Inc., Campbell, CA) in 0.1 ml PBS on the day of immunization and again 48 h later. Mice bred onto the C57Bl/6 genetic background were immunized with 50 μg rMOG in the same way as described above, but without the use of pertussis toxin. Animals were monitored daily for clinical symptoms and weight.

For the clinical evaluation of EAE, the following scale was used: 0, no clinical disease; 1, tail weakness; 2, paraparesis (incomplete paralysis of one or two hindlimbs); 3, paraplegia (complete paralysis of one or two hindlimbs); 4, paraplegia with forelimb weakness or paralysis; and 5, moribund or dead animals.

To analyze the neuropathology, mice were perfused with 4% paraformaldehyde. Brain and spinal cord were removed, postfixed for another 24 h, and routinely embedded in paraffin. The extent of inflammation and demyelination was evaluated on 3-μm spinal cord cross sections stained with hematoxylin/eosin and Klüver Barrera myelin stain.

T Cell Lines.

SJL mice were immunized with 100 μg of peptides PLP 139–154 and PLP 130–151 (28) for establishment of T cell lines GK and IH, respectively. 10 d later, cells isolated from draining LNs were cultured at 5 × 10⁶ cells/ml in the presence of 10 μg/ml PLP peptide for 3 d. After growing cells for 10–14 d in IL-2–containing DMEM (GIBCO BRL), the cells were restimulated with antigen and irradiated (4,000 rads) syngeneic spleen cells; the specificity was assessed by [³H]thymidine (Amersham International) incorporation for the last 16–18 h of a 3-d culture period. Activated T cells were harvested on Lymphoprep™ (Nycomed, Oslo, Norway), washed once, and injected via the tail vein into mice. Animals were scored daily for clinical signs of EAE as described above.

Generation of MOG-specific Ig Gene–targeted Mice.

The entire J_H cluster of the Ig H chain gene locus was replaced by the rearranged VDJ gene segment of MOG-specific mAb 8.18-C5 (Fig. 1 A). Germline chimeric mice generated by introducing gene-targeted ES cells into blastocysts gave rise to mutant progeny at normal efficiency (Fig. 1 B). The transgenic mice were backcrossed onto both C57Bl/6 and SJL/J genetic backgrounds. Endogenous and transgenic Ig H chains can be readily identified serologically by their allotypes. C57Bl/6 and SJL/J mice produce Ig of allotype b (Igh ^b), whereas the targeted Ig H gene locus is derived from the strain 129/Sv, with allotype a (Igh ^a).

The total level of serum IgM of the transgenic (a) allotype in hetero- or homozygous knock-in mice (Th/+ and Th/ Th, respectively) is comparable to the serum levels in F1 mice heterozygous for the IgM^a and IgM^b alleles (Fig. 2 A). In contrast to Th/+ heterozygous knock-in mice, where serum IgM^b levels are slightly reduced, no IgM^b can be detected in Th/Th mice (Fig. 2 A). MOG-binding IgG and IgM^a are found exclusively in naive Th/Th and Th/+ mice but not in wild-type nontransgenic F1 mice (Fig. 2 A).

The antigen specificity of the serum Igs derived from transgenic mice was verified by Western blotting. Sera from knock-in but not from nontransgenic littermates bound to rat rMOG, as well as to native mouse brain MOG (Fig. 2 B). The transgenic Abs showed a binding pattern identical to the MOG-specific “donor” mAb 8.18-C5.

Distribution and Development of B Cells in Th Mice.

Flow cytometric analysis of B lymphocytes obtained from knock-in animals confirmed that autoreactive MOG specificity is not confined to a small subpopulation. Abs specific for transgenic IgM (IgM^a) bound to the vast majority of resting B lymphocytes in the spleen of Th/+ mice, documenting the predominant use of the transgenic Ig H chain. Only a minority of B cells (1–4%) express endogenous Ig H chains (Fig. 3 A, top). Staining of these few B cells is not due to an artifact, but seems to represent a minor IgM^b- labeled subpopulation specific for Th/+ mice, since such cells are completely absent in Th/Th mice (Fig. 3 C). Thus, allelic exclusion leads to exclusive expression of the mutant Ig H allele.

Interestingly, in Th/+, up to 30% and in Th/Th, up to 50% of IgM^a-positive B cells bound biotin-tagged, rMOG protein (Fig. 3, A and C). Using rabbit antiidiotypic Abs recognizing specifically the V region of the H chain of 8.18-C5 (24), we confirmed that the overwhelming majority of transgenic B cells indeed express the 8.18-C5 V_H idiotype (Fig. 3 A). This excludes the possibility that editing of the original gene-targeted V region has occurred within the IgM^a-positive B cell population that is unable to bind MOG, and suggests that many but not all endogenous L chains can associate with the transgenic H chain to generate a functional MOG-specific Ab.

The total number of B and T cells and the distribution of T cell subsets in the spleen and LNs of both Th/+ heterozygous and Th/Th homozygous animals were indistinguishable from wild-type control organs (not shown), indicating normal differentiation of transgenic B lymphocytes. Analysis of early B cell differentiation in the bone marrow of adult Th/+ mice confirmed this assumption. The number and distribution of B cell precursors in the bone marrow of these mice were identical to that seen in wild-type littermates as assessed by the surface expression of the differentiation markers B220, CD43, and IgM (Fig. 3 B). In addition, MOG-specific B cells appear in the bone marrow at a frequency similar to that found in the periphery (Fig. 3, A and B).

The analysis of the peritoneal B cell compartment, the main milieu of B-1 lymphocytes, revealed that due to allelic exclusion, the transgenic IgM^a H chain was also dominant in the peritoneal B cell population (Fig. 4). The proportion of MOG-binding IgM^a B cells was comparable to that seen in other lymphoid organs (Fig. 4). However, the proportion of CD5⁺ B-1 subset B cells, characterized by low levels of IgD and B220, was severely reduced in the peritoneum of the mutant mice (Fig. 4).

These results demonstrate that association of the targeted Ig H chain with endogenous L chains generate autoreactive MOG-specific B cells which differentiate without restriction in the bone marrow and subsequently colonize the immune organs of Th mice.

Response of Transgenic B Cells to Immunization against MOG.

We have shown that in naive transgenic mice, neither are autoreactive MOG-specific B cells deleted, nor are their Ig receptors edited through secondary rearrangements of the transgenic Ig H chain. Also, the density of surface IgM receptors on the populations of B cells that do and do not bind MOG is identical in transgenic animals and similar to that seen in nontransgenic littermates. This argues against anergy of autoreactive B cells (Fig. 3). More cogent evidence for the functional state of autoreactive transgenic B cells comes from immunization of Th/+ mice with recombinant MOG in CFA. This treatment induces a MOG-specific Ab response, with the synthesis of both IgG1 and IgG2a Igs, which are indicative of normal isotype switching (Fig. 5 A).

Our knock-in Th mice are “single-transgenics,” with only the Ig H chain modified by insertion of a MOG-specific VDJ region. Therefore, L chains used by transgenic B lymphocytes are from endogenous origin, and upon immunization with MOG, this diverse L chain use could result in novel epitope specificities differing from that of the original 8.18-C5 hybridoma. The mAb 8.18-C5 recognizes a nonlinear, conformational but SDS-resistant epitope within the extracellular Ig-like domain of MOG (our unpublished observations). This original specificity pattern was maintained in MOG-immunized Th/+ mice, where no response was detected to a panel of peptides covering the entire rMOG protein (Fig. 5 B). In contrast, the Ab response in immunized wild-type littermates recognizes multiple linear MOG peptide epitopes, mainly located in the amino acid sequences 1–25 and 50–71 (Fig. 5 B). The absence of these MOG peptide–specific responses in Th mice strongly suggests that the immune response against MOG in knock-in mice is dominated by transgenic B cells of the same specificity as in the original hybridoma 8.18-C5.

Somatic hypermutation of Ig V regions is a hallmark of the B cell immune response. To document somatic mutations within the targeted VDJ gene, we amplified the gene-targeted VDJ region linked to constant regions of γ isotypes via reverse transcription PCR from mRNA from the spleens of MOG-immunized homozygous Th/Th mice, and determined individual sequences after cloning. Replacement mutations are already detectable in the transgenic V region before immunization (Fig. 6). These mutations are scattered throughout the entire V sequence without marked accumulation in the CDR3 region (0.06 mutations/amino acid in the framework regions versus 0.1 in the CDR regions). However, at day 14 after immunization, the total replacement to substitution (R/S) ratio (R/S: 3.4) was three times higher than in preimmune sequences (R/S: 1.4), and for the CDR3 region, this increase was tenfold (R/S: 1.5 at day 0 versus R/S: 14.5 at day 14 after immunization; Fig. 6). Although care must be taken correlating sequence data with antigen specificity, the enhanced frequency of replacement mutations in the CDR3 region of the gene-targeted V_H gene is indicative of an antigen-driven process.

We conclude that the MOG-specific transgenic B cells in Th mice arise and develop normally, are not anergized in peripheral immune organs, and are functionally competent and fully able to sustain mature humoral immune responses on immunization with the cognate antigen.

MOG-specific B Cells Are Conditionally Pathogenic.

We have demonstrated the persistence of functionally reactive autoreactive MOG-specific B cells in the Th mice, and showed high titers of MOG-specific serum autoantibody. Yet the mutant mice developed neither neurological deficits nor CNS pathology during a period of over one year. The intact endothelial blood–brain barrier (BBB) and intrinsic protective mechanisms in the CNS (29) seem to be sufficient to protect the mice against the potentially pathogenic B cells and their autoantibody products. However, the pathogenic potential of this MOG-specific population of B cells was revealed in the context of a CNS-specific inflammatory response.

Th mice were backcrossed onto SJL and C57Bl/6 strains, which differ markedly in their susceptibility to EAE. Wild-type SJL mice are highly responsive to immunization with either PLP peptide 139–154 or rMOG protein (reference 28, and our unpublished observations). In SJL mice actively immunized with the PLP peptide, the presence of the transgene accelerated disease onset and aggravated the neurological deficit to a mean maximal disease score of 4.9, as opposed to 2.1 in the littermate controls (Table 1, and Fig. 7). Histopathological analysis revealed that accelerated disease development was associated with widespread CNS inflammation and demyelination by day 9 after immunization in the mutant Th mice, at which time wild-type controls showed no CNS lesions (Fig. 8). As opposed to the relatively mild, relapsing course of disease seen in nontransgenic littermate mice, EAE actively induced in transgenic mice with PLP peptide was severe; remission was observed in only one Th animal, and this was followed by a fatal relapse (Fig. 7, and Table 1).

In contrast to the high susceptibility of SJL mice, C57Bl/6 mice are PLP resistant and only partially susceptible to EAE induced with rMOG protein (reference 30, and our unpublished observations). In transgenic C57Bl/6 mice, the incidence of MOG-induced disease was 70 ± 13%, whereas in wild-type littermates, the incidence was only 29 ± 19% (Table 1).

In transgenic SJL mice, disease onset was also accelerated upon adoptive transfer of PLP peptide–specific SJL T cell lines. These T cell lines induce severe and ultimately lethal EAE in normal SJL mice, but disease onset consistently occurred 3–4 d earlier in the SJL-backcrossed Th/+ animals compared with their littermates, irrespective of the dose of T cells transferred (Table 2). As the T cell lines are PLP-, not MOG-specific, we can exclude the possibility of antigen- dependent cooperation with the transgenic MOG-specific B cell population that could enhance T cell proliferation or conversely activate resident B cells. Therefore, the accelerated onset of disease seen in the Th/+ mice probably represents the pathologic effects of MOG-specific Abs that rapidly amplify the inflammatory/demyelinating response in the CNS (31).

Treatments that do not interfere with BBB permeability, such as pertussis toxin alone, immunization with foreign antigens such as KLH, or the passive transfer of KLH-specific T cells, failed to provoke CNS disease in transgenic mice (data not shown).