Abstract
New treatment strategies for ovarian cancer, which is the deadliest female reproductive tract malignancy, are urgently needed. Here, we investigated the anticancer effects of fenbendazole (FBZ), a benzimidazole compound, on the regulation of apoptosis and mitotic catastrophe in A2780 and SKOV3 human epithelial ovarian cancer cells. Functional experiments, including Cell Counting Kit 8 (CCK-8), colony formation, and flow cytometry assays, were conducted to explore the effects of FBZ on the malignant biological behavior of A2780 and SKOV3 cells. RNA sequencing and western blotting were utilized to elucidate the underlying mechanisms by which FBZ affects cell apoptosis. We found that FBZ inhibited the proliferation and promoted the apoptosis of ovarian cancer cells in a dose-dependent manner. Furthermore, we reported the transcriptome profiling of FBZ-treated SKOV3 ovarian cancer cells. In all, 1747 differentially expressed genes (DEGs) were identified, including 944 downregulated and 803 upregulated genes. KEGG enrichment and Reactome enrichment analyses revealed that the DEGs were associated mainly with mitosis- and cell cycle-related pathways. Additionally, we found that FBZ may promote apoptosis via mitotic catastrophe. Finally, oral administration of FBZ inhibited tumor growth in a mouse model of xenograft ovarian cancer. Overall, these findings suggest that FBZ has therapeutic potential for the treatment of ovarian cancer.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12885-024-13361-9.
Keywords: Fenbendazole, Ovarian cancer, Apoptosis, Mitotic catastrophe
Introduction
Ovarian cancer is one of the most commonly diagnosed gynecological malignant tumors. Although it is estimated that ovarian cancer does not rank among the top ten most diagnosed malignant tumors in females in the United States, it has ranked as the sixth leading cause of cancer-related death among women in 2024 [1]. In China, cancer statistics indicate that the number of deaths caused by ovarian cancer was 32,600 in 2022, which accounts for 3.45% of all cancer-related deaths of females in China [2], which means it is one of the major health threats to women. Currently, the standard care for ovarian cancer patients is surgical cytoreduction followed by chemotherapy ± maintenance treatment. However, the five-year survival rate of patients with ovarian cancer has steadily remained unchanged at approximately 30–40% [3]. Therefore, additional and better treatment strategies or drugs are urgently needed to improve the prognosis of patients with ovarian cancer.
Mitotic catastrophe, which can emerge at all stages of mitosis, is a phenomenon of cell death and an oncosuppressive mechanism that occurs when the process of mitosis is dysregulated. The main characteristics of mitotic catastrophe include the formation of multinucleated giant cells, DNA polyploidization, G2/M cycle arrest, and alteration of the microtubule network [4–6]. The appearance of multinucleation or micronuclei in the nucleus is the most prominent morphological feature of mitotic catastrophe [7]. Whether mitotic catastrophe is a new mode of cell death or a precursor of cell apoptosis, necrosis, or autophagy, as the characteristic phenomena of apoptosis and necrosis are also observed in cells undergoing mitotic catastrophe, is still controversial [8–12]. Mitotic catastrophe has been shown to be a promising antitumor mechanism [12], as the classic anti-ovarian cancer drug paclitaxel can also induce tumor cells to undergo mitotic catastrophe, thereby killing the cells [13]. Interestingly, we found that FBZ could also cause mitotic catastrophe in human ovarian cancer cells.
Fenbendazole (FBZ), a benzimidazole compound, is widely used to treat parasitic infections in animals [14, 15]. Previous studies have shown that FBZ has high antitumor potential and is capable of regulating various cell signaling pathways and functions of tumor cells [16]. Additionally, FBZ has been shown to induce mitotic catastrophe in cervical cancer cells and colon cancer cells [17]. To our knowledge, previous studies have reported the anti-ovarian cancer activity of FBZ-incorporated poly(lactic-co-glycolic acid (PLGA) nanoparticles and FBZ encapsulated in methoxy poly(ethylene glycol)-b-poly(caprolactone) polymeric micelles [18, 19]. However, the anticancer effects of FBZ in A2780 and SKOV3 ovarian cancer cells have not been intensively studied, and thus the mechanism is also unclear. Therefore, we aimed to investigate (1) the effects of FBZ on the proliferation and apoptosis of human ovarian cancer cells and the underlying mechanisms in vitro and in vivo and (2) the effects of FBZ on tumor growth in a xenograft ovarian cancer mouse model.
Materials and methods
Reagents and antibodies
Fenbendazole (FBZ, Cat: F810011) and Z-VAD-FMK (Z-VAD, pancaspase inhibitor, Cat: Z860402) were purchased from Macklin (Shanghai, China). Dimethyl sulfoxide (DMSO) was purchased from Servicebio (Wuhan, China). These reagents were dissolved in DMSO to prepare stock solutions at concentrations of 100 mM and 5 mM for FBZ and Z-VAD-FMK, respectively. The solutions were stored at -20 °C and diluted in fresh complete medium to prepare working concentrations. Anti-caspase-3 (Cat: 19677-1-AP), anti-cleaved caspase-3 (Cat: 25128-1-AP), anti-BAX (Cat: 60267-1-Ig), anti-B-cell lymphoma-2 (anti-BCL-2, Cat: 68103-1-Ig), and anti-α-tubulin (Cat: 66031-1-Ig) antibodies were purchased from Proteintech (Wuhan, China). Anti-cyclin B1 (Cat: A00745-1) and anti-β-tubulin (Cat: BM1453) antibodies were purchased from Boster (Wuhan, China). Anti-β-actin (Cat: GB15003) antibody was purchased from Servicebio (Wuhan, China). Anti-cyclin-dependent kinase 1 (anti-CDK1, Cat: DF6024) and anti-phosphorylated cyclin-dependent kinase 1 (anti-p-CDK1, Cat: AF3236) antibodies were purchased from Affinity Biosciences (Jiangsu, China).
Cell culture
The human epithelial ovarian cancer cell lines A2780 and SKOV3 were purchased from BNCC (Beijing, China) and Pricella (Wuhan, China), respectively. A2780 cells were cultured in RPMI 1640 (Gibco, NY, USA), while SKOV3 cells were cultured in McCoy’s 5 A medium (Gibco, NY, USA) supplemented with 10% fetal bovine serum (Vivacell, China) and 1% penicillin‒streptomycin (Gibco). The cell lines were authenticated by short tandem repeat (STR) profiling before the experiment and cultured at 37 °C in an atmosphere with 5% CO2.
Cell viability and colony formation assays
Cell viability assay
The cells were seeded in a 96-well plate (5000 cells/well), incubated overnight, and treated with various concentrations of FBZ (0.0390625-20 µM for A2780 cells and 0.1953125-100 µM for SKOV3 cells). The viability of ovarian cancer cells was determined at 24 h, 48 h, and 72 h after treatment with FBZ using a Cell Counting Kit-8 (CCK-8, Med Chem Express, Shanghai, China) assay according to the manufacturer’s instructions. At each time point, the old complete medium was discarded and replaced with 100 µL fresh medium. Following this, 10 µL of CCK-8 solution was added to each well and incubated for 2 h at 37℃. The optical density (OD) was measured at 450 nm using a Multiskan Mk3 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Cell viability was calculated as follows: cell viability = [(OD value of treated group - OD value of blank)/ (OD value of control group - OD value of blank)] × 100%.
Colony formation assay
A2780 and SKOV3 cells were cultured in 6-well plates (500 cells per well) and treated with different concentrations of FBZ for 48 h. Then, the drug-containing medium was discarded, and the cells were cultured in normal complete medium for 1 ∼ 2 weeks. After one or two weeks of incubation, the cells were fixed in 4% paraformaldehyde and stained with crystal violet solution (Biosharp, Beijing, China). Colonies consisting of more than 50 cells were counted via microscopy, and images were obtained (Leica Microsystems, Germany). ImageJ software was used to analyze the images. This experiment was repeated three times.
Cell apoptosis and cell cycle analysis
Cell apoptosis analysis
The cells were treated with different concentrations of FBZ for 48 h after which the cells were harvested and incubated with Annexin V-FITC and PI solution (Life-iLab, Shanghai, China) in the dark for 15 min. After they were washed with 400 µL of binding buffer and filtered once through a cell strainer, the stained cells were immediately analyzed using a NovoCyte 2060R flow cytometer (Agilent Technologies, Hangzhou, China).
Cell cycle analysis
The cells were treated with different concentrations of FBZ for 24 h. Then, the cells were harvested and fixed in 500 µL of 70% cold ethanol at 4 °C overnight. The fixed cells were subsequently washed once with phosphate-buffered saline (PBS), treated with RNase A, and stained with propidium iodide (Solarbio, Beijing, China) in the dark for 30 min. Then, the stained cells were immediately analyzed using a NovoCyte 2060R flow cytometer (Agilent Technologies, Hangzhou, China).
Western blot
The protocol was adapted from a previous study by our team with appropriate modifications [20]. After sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the proteins were transferred from the gels to a polyvinylidene difluoride (PVDF) membrane. Then, the PVDF membrane was blocked with 5% bovine serum albumin for 2 h at room temperature. The target protein bands on the PVDF membrane were cut according to the molecular size of the protein marker and incubated with the corresponding primary antibodies overnight at 4 °C. After they were washed three times in TBST, the PVDF membrane was incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at 20–25 ℃. An Excellent Chemiluminescent Substrate assay kit (Boster, Wuhan, China) was used to visualize the immunoblot. The images were acquired with a Tannon-4600SF chemiluminescent imaging system (Tannon, Shanghai) and quantified via Image-Pro Plus version 6.0 software (Media Cybernetics, Rockville, USA).
RNA sequencing and transcriptome analysis
SKOV3 cells treated with 0 µM or 1 µM FBZ for 48 h served as the control and treatment groups, respectively. Each group included three biological replicates. The methods for total RNA extraction, RNA sequencing library generation, and RNA sequencing were adapted from a previous study by our team [20]. Differential expression analysis of the two groups was performed via DESeq2 (v 1.30.1). Genes with an adjusted P < 0.05 and |log2(FC)| ≥ 1, as determined by DESeq2, were considered differentially expressed genes (DEGs). The DEGs were subjected to Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, and Reactome analyses.
Quantitative real-time polymerase chain reaction (RT-qPCR)
Total RNA was isolated from SKOV3 cells treated with or without 1 µM FBZ using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized from total RNA using reverse transcription kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. The qPCR reaction mixture was prepared using the TIANGEN FastKing RT Kit (with gDNase; KR116, Tiangen Biotech; Beijing, China) and SuperReal PreMix Plus (SYBR Green; FP205, Tiangen Biotech; Beijing, China) following the manufacturer’s instructions. The reaction mixture was then distributed into 96-well qPCR plates. RT-qPCR was performed using a One Step plus7500 real-time PCR system. Relative expression of selected DEGs were calculated using the 2 ^ (-ΔΔCt) method. GAPDH was used as the control. All primers used for RT-qPCR were synthesized by Sangon Biotech (Shanghai, China) and are listed in Table 1.
Table 1.
Primer sequences of DEGs
| Gene name | Sequences(5′-3′) |
|---|---|
| CEBPD | Forward primer: AGCGCAACAACATCGCCGTG |
| Reverse primer: GTCGGGTCTGAGGTATGGGTC | |
| CDC25C | Forward primer: AAAGGCGGCTACAGAGACTTC |
| Reverse primer: AGCCCAGAGAGAAAGAGTTGG | |
| DLGAP5 | Forward primer: TCCGACCTGGTCCAAGACAA |
| Reverse primer: GACGTGGGCATTACAGGC | |
| TPX2 | Forward primer: ATGGAACTGGAGGGCTTTTTC |
| Reverse primer: TGTTGTCAACTGGTTTCAAAGGT | |
| GAPDH | Forward primer: CGGAGTCAACGGATTTGGTC |
| Reverse primer: AGCCTTCTCCATGGTCGTGA |
Immunofluorescence assay
The cells (1 × 105 cells per well) were seeded onto sterilized coverslips in 6-well plates and were treated with or without FBZ for 24 h. The cells were then washed three times with PBS and fixed in 4% poly-methanol for 15 min. Next, the cells were washed three times with cold PBS and permeabilized with 0.1% Triton X-100 (Beyotime, Shanghai, China) for 10 min. After nonspecific binding was blocked with 10% goat serum for 35 min, primary antibodies were added, and the cells were incubated overnight at 4 ℃. The cells were then incubated with the secondary antibody (Abbkine, Wuhan, China) at room temperature away from light for 1 h. Finally, the slides were sealed with anti-fluorescence quenching sealing agents containing 4’,6-diamidino-2-phenylindole (DAPI, Beyotime, Shanghai, China) and observed under a fluorescence microscope (Leica Microsystems, Germany).
Tumor xenograft assay
Sixteen 4-week-old female BALB/c nude mice were purchased from Spivey (Beijing) Biotechnology Co. The nude mice were maintained in the specific pathogen-free grade laboratory animal building at the Institute of Medical Biology, Chinese Academy of Medical Sciences. After one week of acclimatization, the nude mice were subcutaneously injected with SKOV3 ovarian cancer cells (8 × 106 cells per mouse). When the tumor volume reached approximately 125 mm3, 16 mice were randomly divided into 2 groups according to the tumor volume. The mice were administered 1% sodium carboxymethyl cellulose (vehicle) or FBZ (50 mg/kg, suspended in 1% sodium carboxymethyl cellulose) by oral gavage once daily for 21 days. The body weights and tumor volumes of the mice were measured every three days. The tumor volume was calculated according to the following formula: tumor volume = length × width2/2. The nude mice with xenografted tumor cells were euthanized by cervical dislocation after the last administration of FBZ, and the tumors were weighed and imaged for further analysis. The animal studies were approved by the Animal Ethics Committee of Kunming Medical University.
Statistical analysis
All the data were statistically analyzed and graphed using IBM SPSS Statistics 26 and GraphPad Prism (version 9.0, GraphPad software, San Diego, CA, USA). The data are expressed as the means ± standard deviations, and Student’s t test, one-way analysis of variance (ANOVA) followed by Tukey’s test, and two-way ANOVA were used for the statistical analysis. P < 0.05 was considered statistically significant. Significance levels are presented as follows: *P < 0.05, **P < 0.01, and***P < 0.001.
Results
FBZ inhibits ovarian cancer cell proliferation
The molecular structure of FBZ is shown in Fig. 1A. The effect of FBZ on cell viability was determined in two different epithelial ovarian cancer cell lines, A2780 and SKOV3, by CCK-8 assay. The results showed that FBZ inhibited the proliferation of A2780 and SKOV3 ovarian cancer cells in a dose- and time-dependent manner (Fig. 1B and C). The half maximal inhibitory concentration (IC50) values were 1.30 µM, 0.44 µM, and 0.38 µM for A2780 cells and 2.83 µM, 1.05 µM, and 0.89 µM for SKOV3 cells at 24, 48, and 72 h, respectively. A colony formation assay was used to further verify these results. The colony-forming ability of A2780 and SKOV3 cells was significantly suppressed by FBZ in a dose-dependent manner (Fig. 1D–F). These results indicate that FBZ significantly inhibits the proliferation of ovarian cancer cells.
Fig. 1.
FBZ inhibits ovarian cancer cell proliferation. (A) Molecular structure of FBZ. (B, C) Effects of different concentrations of FBZ on the viability of A2780 (B) and SKOV3 (C) cells at 24 h, 48 h, and 72 h. (D–F) The inhibitory effects of different concentrations of FBZ on the colony formation ability of A2780 and SKOV3 cells after 48 h of treatment. The data are shown as the means ± SDs. *P < 0.05;***P < 0.001 versus the control group
FBZ promotes ovarian cancer cell apoptosis
To evaluate the effect of FBZ on apoptosis, flow cytometry analysis was performed after A2780 and SKOV3 cells were double-stained with annexin V-FITC/PI. The results indicated that the percentage of apoptotic ovarian cancer cells in the FBZ-treated group were significantly increased in a dose-dependent manner compared with that in the control group (Fig. 2A–D). The expression of apoptosis-associated proteins was also determined by WB. The protein levels of cleaved caspase-3 and the BAX/BCL-2 protein ratio were significantly increased by FBZ in A2780 and SKOV3 cells. In addition, the protein levels of caspase-3 tended to increase (Fig. 2E–G).
Fig. 2.
FBZ promotes ovarian cancer cell apoptosis. (A–D) Analysis of apoptosis in FBZ-treated ovarian cancer cells. (E–G) Expression of the apoptosis-associated proteins cleaved caspase-3, caspase-3, BAX, and BCL-2 after FBZ treatment. The data are shown as the means ± SDs. *P < 0.05;**P < 0.01;***P < 0.001 versus the control group
Next, we used the caspase inhibitor Z-VAD-FMK to further investigate whether FBZ could promote ovarian cancer cell apoptosis. The CCK-8 assay results revealed that pretreatment with 10 µM Z-VAD-FMK significantly restored the viability of A2780 and SKOV3 cells treated with FBZ (Fig. 3A and B). The apoptosis rate of the FBZ-treated A2780 cells reached 33.30%, while the apoptosis rate of the Z-VAD-FMK plus FBZ combination group was only 9.34%. The apoptosis rate of the SKOV3 cells treated with FBZ alone reached 54.28%, while the apoptosis rate of the Z-VAD-FMK plus FBZ combination group was only 8.11%, which indicated that the apoptosis inhibitor Z-VAD-FMK could partially reverse the apoptotic effect of FBZ on ovarian cancer cells (Fig. 3C–F). These results further verify that FBZ promotes the apoptosis of ovarian cancer cells.
Fig. 3.
Z-VAD can partially counteract the ability of FBZ to promote ovarian cancer cell apoptosis. (A, B) Effects of treatment with an apoptosis inhibitor followed by the addition of FBZ on the viability of ovarian cancer cells. (C–F) Flow cytometry analysis of apoptosis in ovarian cancer cells treated with Z-VAD followed by the addition of FBZ. The data are shown as the means ± SDs. *P < 0.05;**P < 0.01;***P < 0.001 versus the control group
Transcriptome analysis of SKOV3 cells treated with FBZ
In the present study, RNA sequencing was performed on SKOV3 cells treated with or without FBZ for 48 h. In all, 1747 DEGs were identified between the FBZ treatment group and the control group, of which 803 were upregulated and 944 were downregulated. The DEG screening criteria were |log2(FC)| ≥ 1 and P < 0.05. GO analysis revealed that the molecular functions, biological processes, and cellular components of the DEGs were associated mainly with the cell cycle and mitosis. KEGG enrichment analysis revealed that the signaling pathways were enriched mainly in the cell cycle, motor protein, cellular senescence, oocyte meiosis, and DNA replication, among others. Reactome enrichment analysis revealed that the signaling pathways were enriched mainly in cell cycle checkpoint, M phase, RHO GTP effector, pre-mitotic, and mid- and late-mitotic pathways, among others. In conclusion, GO, KEGG enrichment, and Reactome enrichment analyses indicated that FBZ affected mainly mitosis- and cell cycle-associated pathways in ovarian cancer cells (Fig. 4A–G).
Fig. 4.
Transcriptome analysis of SKOV3 cells following FBZ treatment. (A) Heatmap analysis showing the transcriptional changes in SKOV3 cells with and without FBZ treatment. (B) Volcano plot of DEGs in FBZ-treated and untreated SKOV3 cells. The blue dots represent downregulated genes, the red dots represent upregulated genes, and the gray dots represent insignificant genes. The X-axis denotes log2-fold change values, and the Y-axis shows the − log10 adjusted p value. (C–E) Dot plot summarizing the gene ontology results of the molecular function, biological process, and cellular component categories of the statistically significant DEGs. The dot size corresponds to the number of DEGs, and the color corresponds to the statistical significance of each molecular function, biological process, or cellular component. (F, G) Bar plot summarizing KEGG enrichment and Reactome enrichment for the statistically significant DEGs. The bar size corresponds to the number of DEGs, and the color corresponds to the statistical significance of each pathway
Verification of the expression levels of DEGs
To validate the RNA-sequencing data, 4 genes (CEBPD, CDC25C, DLGAP5, TPX2) about cell cycle regulation were selected among the DEGs, and their expression levels were determined by RT-qPCR. Our results showed that CDC25C, DLGAP5 and TPX2 were up-regulated by the treatment of FBZ, while CEBPD were down-regulated. The mRNA expression level of selected DEGs in SKOV3 cells treated with FBZ was consistent with the result of transcriptome(Fig. 5A-B), providing evidence on the reliability of the RNA-sequencing results.
Fig. 5.
Validation of gene expression by quantitative real-time PCR. (A) The transcriptome results of selected genes. (B) Relative mRNA expression levels of CDC25C, CEBPD, DLGAP5, and TPX2 were analyzed in SKOV3 cells treated with FBZ for 48 h or untreated control cells. Gene expression was normalized relative to the expression of GAPDH. FPKM: Fragments Per Kilobase of exon model per Million mapped fragments. *P < 0.05;***P < 0.001 versus the control group
FBZ induces mitotic catastrophe in ovarian cancer cells
The phenomena of cell multinucleation and micronuclei are considered the most prominent morphological changes that occur in mitotic catastrophe. To investigate whether FBZ could induce mitotic catastrophe in A2780 and SKOV3 ovarian cancer cells, we treated these cells with FBZ at the IC50 for 48 h. Then, DAPI staining was used to evaluate the morphological changes in the cell nuclei. The results revealed that multinucleation and micronuclei were both present in the group treated with FBZ but not in the control group (Fig. 6A). Immunofluorescence assays were also performed in the present study. We found that the cell nuclei appeared multinucleated 24 h after FBZ treatment. After staining for α-tubulin, spindle disorganization was also observed in the FBZ-treated group but not in the control group (Fig. 6B).
Fig. 6.
FBZ induces mitotic catastrophe in A2780 and SKOV3 ovarian cancer cells. (A) DAPI staining was performed to detect nuclei and morphological changes in the nuclei of A2780 and SKOV3 cells after FBZ treatment. (B) An immunofluorescence assay was used to detect the nucleus and spindle organization in A2780 and SKOV3 cells. (C) Cell cycle analysis of A2780 and SKOV3 cells was conducted by flow cytometry with PI staining. (D, E) Percent distribution of A2780 and SKOV3 cells in different phases of the cell cycle upon FBZ treatment. (F–H) Western blotting was used to detect changes in the expression of cell cycle-associated proteins in A2780 and SKOV3 cells 24 h after FBZ treatment. The data are shown as the means ± SDs, *P < 0.05; **P < 0.01; ***P < 0.001 versus the control group
To further validate the mitotic catastrophe induced by FBZ, cell cycle changes were determined by flow cytometry. The results revealed that FBZ induced cell cycle arrest at G2/M phase after 12 h (Supplementary Fig. 1A–C) and 24 h (Fig. 6C–E) of treatment and that the proportion of arrested A2780 and SKOV3 cells significantly increased in a dose-dependent manner. Western blotting was also used to detect the expression of the cell cycle-related proteins cyclin B1, CDK1, and p-CDK1 in A2780 and SKOV3 cells 12 h and 24 h after FBZ treatment. The protein expression of cyclin B1, CDK1, and p-CDK1 in A2780 and SKOV3 cells tended to increase 12 h after FBZ treatment (Supplementary Fig. 1D–F). The protein expression levels of cyclin B1 and p-CDK1 in A2780 and SKOV3 cells tended to increase, whereas the expression level of the CDK1 protein decreased, 24 h after FBZ treatment (Fig. 6F–H).
FBZ inhibits the growth of ovarian cancer tumors in vivo
Given that FBZ induced cell death in ovarian cancer cells by promoting apoptosis and inducing mitotic catastrophe in vitro, we next used a SKOV3 cell xenograft model in BALB/c nude mice to investigate whether FBZ could exert antitumor effects in vivo (the experimental flowchart is shown in Fig. 7A). By analyzing the body weight growth curves of the nude mice, we found no significant difference between the FBZ-treated group and the control group (Fig. 7F). However, the tumor size was significantly decreased in the FBZ-treated group compared with that in the control group (Fig. 7B–D). The tumors were removed and weighed after the nude mice were sacrificed, and we observed that the tumor weight was clearly lower in the FBZ-treated group than in the control group (Fig. 7E). These results indicate that oral administration of FBZ could effectively inhibit tumor growth in a xenograft ovarian cancer mouse model.
Fig. 7.
FBZ inhibits the growth of ovarian cancer tumors in vivo. (A) Flowchart of the animal experiment (generated using FigDraw). (B–C) Images of nude mice at the end of the experiment and tumor morphology after tumor formation in the vehicle and FBZ groups. (D) Time-tumor volume curves of the vehicle group vs. the FBZ group. (E) Comparison of tumor weights between the vehicle and FBZ groups. (F) Time-weight curves of the nude mice in the vehicle group and the FBZ group
Discussion
Among patients with newly diagnosed advanced ovarian cancer, 70% will relapse within 3 years even if they receive standard treatment. Chemoresistance ultimately occurs due to multiple lines of chemotherapy, which leads to treatment failure [21]. Therefore, the discovery of new treatment strategies to increase clinical treatment efficacy is important. Fenbendazole, an artificial compound that belongs to the benzimidazole family, is widely used to treat parasitic diseases in animals. Previous studies have shown that fenbendazole exerts good antitumor effects against various cancers, such as lung cancer [22, 23], melanoma [24], cervical cancer [17], 5-fluorouracil-resistant colorectal cancer [25], and liver cancer [26]. Although Shin YB and Chang CS reported that FBZ-incorporated PLGA nanoparticles or micelles containing FBZ exhibit anti-ovarian cancer activity, the underlying mechanism is still unclear [18, 19]. In line with these studies, our work indicated that FBZ promoted apoptosis, inhibited the proliferation of ovarian cancer cells in vitro and inhibited the growth of ovarian cancer tumors in vivo. Both transcriptome sequencing and a caspase inhibitor were utilized to investigate the anti-ovarian cancer mechanism of FBZ, which demonstrates its potential as a novel candidate antitumor drug [6].
Apoptosis is a classic mode of programmed cell death in which cytochrome C is released from mitochondria when the mitochondrial outer membrane permeabilizes. Cytochrome C forms apoptosomes with Apaf-1 and caspase-9, which activates caspase-3 and ultimately leads to apoptosis [27]. Our data showed that FBZ could induce the apoptosis of ovarian cancer cells in a dose-dependent manner. The expression levels of the proapoptotic proteins cleaved caspase-3 and BAX were also significantly increased, which indicates the occurrence of apoptosis. However, the expression level of the antiapoptotic protein BCL-2 was not significantly decreased. BCL-2 can inhibit BAX activity, and an increase in the BAX/BCL-2 ratio plays an important role in the regulation of apoptosis [28, 29]. When the BCL-2 protein is bound by BH3-only proteins, the inhibitory effect of BAX is removed, which promotes increased mitochondrial outer membrane permeabilization and leads to apoptosis [30]. From our perspective, although FBZ exerted no notable effect on the protein expression of BCL-2, an increase in the BAX/BCL-2 ratio promoted apoptosis. Previous studies have reported that the caspase family plays an important role in the apoptosis pathway. Z-VAD-FMK, a common pancaspase inhibitor, is widely used to explore the role of the caspase-dependent apoptosis pathway in cells [31, 32]. To further investigate whether FBZ induces cell apoptosis via a caspase-dependent pathway, we inhibited apoptosis. The results showed that Z-VAD-FMK partially prevented death and the apoptosis-promoting effects of FBZ in ovarian cancer cells, which indicates that the caspase-dependent apoptosis pathway is involved in the antitumor effects of FBZ.
In the present study, we demonstrated that FBZ significantly altered the transcriptome of SKOV3 ovarian cancer cells. GO, KEGG and Reactome enrichment analyses revealed that the DEGs were enriched mainly in pathways related to mitosis and the cell cycle, which suggests that the antitumor effect of FBZ may be associated with mitosis and the cell cycle. Mitotic catastrophe is a cell death phenomenon that occurs due to an imbalance in the mitotic process and is a type of oncosuppressive mechanism [7]. Researchers have reported that DNA damage, mitotic defects, and failure of cytoplasmic division can induce mitotic catastrophe [4, 5]. Kim S reported that FBZ can cause cell cycle arrest in G2/M phase in canine melanoma cells, which leads to mitotic catastrophe [33]. In 5-fluorouracil-resistant colorectal cancer, FBZ can cause cell cycle arrest in G2/M phase and induce apoptosis through the p53‒p21 pathway [25]. Flubendazole, which belongs to the benzimidazole family, can cause cell cycle arrest at G2/M phase in melanoma cells and induce mitotic catastrophe, thereby promoting cell apoptosis [34]. Consistent with previous studies, our work also revealed that FBZ can induce mitotic catastrophe, including multinucleated cells, spindle disorders, and dose-dependent G2/M arrest in ovarian cancer cells.
Cyclin B1 is expressed mainly in S phase, peaks in G2 phase, is maintained until the middle of M phase, and rapidly decreases in late M phase through the ubiquitination pathway. The phosphorylation status of CDK1 is closely related to cell cycle progression. CDK1 activity is inhibited by its phosphorylation, which leads to delayed mitosis [35]. At the end of G2 phase, cyclin A activates CDK1 to initiate mitosis. When the nuclear membrane ruptures, cyclin A is degraded, which facilitates the formation of the CDK1/cyclin B1 complex (cell maturation promoting factor) and promotes the transition from G1/S phase to G2/M phase [36, 37]. During the G2/M phase transition, the bispecific protein phosphatase Cdc25C interacts with CDK1 and dephosphorylates it, which prompts the nuclear translocation of the cyclin B1/CDK1 complex and promotes mitosis [38, 39]. Our results indicated that the protein expression of p-CDK1 is significantly increased in ovarian cancer cells treated with FBZ, which suggests that FBZ can inactivate CDK1. Both the upregulation of cyclin B1 and the inactivation of CDK1 can cause cell cycle arrest in G2/M phase [40]. Previous studies have reported that the changes in the expression of cyclin B1 after FBZ treatment in tumor cells are diverse. In 5-fluorouracil-resistant colorectal cancer cells, cyclin B1 expression is not affected by FBZ [25] but is downregulated in liver cancer cells [26]. In canine melanoma, the expression level of cyclin B1 briefly increases and then decreases [33]. In this study, we found that cyclin B1 expression was significantly upregulated in ovarian cancer cells treated with FBZ. Although no similar studies have reported that FBZ can lead to the accumulation of cyclin B1, albendazole, which belongs to the benzimidazole family, can promote apoptosis of human gastric cancer cells by disrupting microtubule formation and function, leading to cell cycle arrest in G2/M phase and the accumulation of cyclin B1 [41].
Conclusion
In summary, we found that FBZ can inhibit proliferation and promote apoptosis of ovarian cancer cells in vitro and inhibit tumor growth in a xenograft ovarian cancer mouse model in vivo. Mechanistically, FBZ can inhibit the formation of cyclin B1/CDK1 complexes by promoting CDK1 phosphorylation, which leads to the accumulation of cyclin B1. The cell cycle is then arrested in G2/M phase, which induces mitotic catastrophe and ultimately leads to tumor cell death (Fig. 8). Our work demonstrated that FBZ has therapeutic potential for the treatment of ovarian cancer.
Fig. 8.
Anti-cancer mechanism of FBZ in ovarian cancer cells (this figure was generated using FigDraw)
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We sincerely thank the Cancer Institute of Yunnan Province and the Cancer Biotherapy Center for providing the scientific research platform.
Author contributions
Conceptualization: H.Z., Y.J. and H.Y.; Writing – Original Draft Preparation, X.W., W.T.; Writing—draft, review, editing: Y.J.; Data curation: Y.J., X.W. and W.T.; Methodology: Y.J., H.Y., X.W. and W.T.; Investigation: N.W., X.Y., L.L. Z.L. T.Z. and C.W.; Supervision and Funding Acquisition: H.Z., H.Y. and Y.J.; All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by grants from Basic Research in Yunnan Province (Kunming Medical University Joint Project): 202201AY070001-138 and 202201AY070001-162. The innovative research team of Yunnan Province (Project Number: 202305AS350020). Yunnan Province “Ten Thousand People Plan” (Grant No. YNWR-MY-2019-039). “Xingdian Talent Support Plan” for Outstanding Doctors in Yunnan Province (Project Number: XDYC-MY-2022-0056).
Data availability
The datasets generated during the current study are available in the Gene Expression Omnibus, GSE275290.
Declarations
Institutional review board statement
This animal experiment protocol was reviewed and approved by the Animal Ethics Committee of Kunming Medical University, and the approval number is kmmu20221422.
Consent for publication
Not applicable.
Conflict of interest
The authors declare no conflicts of interest, and all the authors have already approved the publication of the manuscript, which is our original unpublished work.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Xin Wang and Wenda Tian contributed equally to this work.
Contributor Information
Hongping Zhang, Email: [email protected].
Hongying Yang, Email: [email protected].
Yue Jia, Email: [email protected].
References
- 1.Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. Cancer J Clin. 2024;74(1):12–49. [DOI] [PubMed] [Google Scholar]
- 2.Zheng RS, Chen R, Han BF, Wang SM, Li L, Sun KX, Zeng HM, Wei WW, He J. Cancer incidence and mortality in China, 2022. Zhonghua Zhong Liu Za Zhi, 46:221–31. [DOI] [PubMed]
- 3.Lheureux S, Gourley C, Vergote I, Oza AM. Epithelial ovarian cancer. Lancet. 2019;393(10177):1240–53. [DOI] [PubMed] [Google Scholar]
- 4.Portugal J, Mansilla S, Bataller M. Mechanisms of drug-induced mitotic catastrophe in cancer cells. Curr Pharm Design. 2010;16(1):69–78. [DOI] [PubMed] [Google Scholar]
- 5.Erenpreisa J, Cragg MS. Mitotic death: a mechanism of survival? A review. Cancer Cell Int. 2001;1(1):1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Dogra N, Kumar A, Mukhopadhyay T. Fenbendazole acts as a moderate microtubule destabilizing agent and causes cancer cell death by modulating multiple cellular pathways. Sci Rep. 2018;8(1):11926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Mc Gee MM. Targeting the mitotic catastrophe signaling pathway in Cancer. Mediat Inflamm. 2015;2015:146282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Castedo M, Coquelle A, Vivet S, Vitale I, Kauffmann A, Dessen P, Pequignot MO, Casares N, Valent A, Mouhamad S, et al. Apoptosis regulation in tetraploid cancer cells. EMBO J. 2006;25(11):2584–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Vakifahmetoglu H, Olsson M, Zhivotovsky B. Death through a tragedy: mitotic catastrophe. Cell Death Differ. 2008;15(7):1153–62. [DOI] [PubMed] [Google Scholar]
- 10.Sazonova EV, Petrichuk SV, Kopeina GS, Zhivotovsky B. A link between mitotic defects and mitotic catastrophe: detection and cell fate. Biol Direct. 2021;16(1):1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Egorshina AY, Zamaraev AV, Kaminskyy VO, Radygina TV, Zhivotovsky B, Kopeina GS. Necroptosis as a novel facet of mitotic catastrophe. Int J Mol Sci. 2022;23(7):3733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bai Z, Zhou Y, Peng Y, Ye X, Ma L. Perspectives and mechanisms for targeting mitotic catastrophe in cancer treatment. Biochim et Biophys Acta (BBA) - Reviews Cancer. 2023;1878(5):188965–188965. [DOI] [PubMed] [Google Scholar]
- 13.Zhao S, Tang Y, Wang R, Najafi M. Mechanisms of cancer cell death induction by paclitaxel: an updated review. Apoptosis. 2022;27(9–10):647–67. [DOI] [PubMed] [Google Scholar]
- 14.Yu CG, Singh R, Crowdus C, Raza K, Kincer J, Geddes JW. Fenbendazole improves pathological and functional recovery following traumatic spinal cord injury. Neuroscience. 2014;256:163–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Mukhopadhyay T, Sasaki J, Ramesh R, Roth JA. Mebendazole elicits a potent antitumor effect on human cancer cell lines both in vitro and in vivo. Clin cancer Research: Official J Am Association Cancer Res. 2002;8(9):2963–9. [PubMed] [Google Scholar]
- 16.Králová V, Hanušová V, Rudolf E, Čáňová K, Skálová L. Flubendazole induces mitotic catastrophe and senescence in colon cancer cellsin vitro. J Pharm Pharmacol. 2016;68(2):208–18. [DOI] [PubMed] [Google Scholar]
- 17.Peng Y, Pan J, Ou F, Wang W, Hu H, Chen L, Zeng S, Zeng K, Yu L. Fenbendazole and its synthetic analog interfere with HeLa cells’ proliferation and energy metabolism via inducing oxidative stress and modulating MEK3/6-p38-MAPK pathway. Chemico-Biol Interact. 2022;361:109983. [DOI] [PubMed] [Google Scholar]
- 18.Chang CS, Ryu JY, Choi JK, Cho YJ, Choi JJ, Hwang JR, Choi JY, Noh JJ, Lee CM, Won JE, et al. Anti-cancer effect of fenbendazole-incorporated PLGA nanoparticles in ovarian cancer. J Gynecologic Oncol. 2023;34(5):e58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Shin YB, Choi JY, Shin DH, Lee JW. Anticancer evaluation of Methoxy Poly(Ethylene Glycol)-b-Poly(Caprolactone) Polymeric Micelles Encapsulating Fenbendazole and Rapamycin in Ovarian Cancer. Int J Nanomed. 2023;18:2209–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yang X, Liu Z, Wang X, Tian W, Zhao T, Yang Q, Li W, Yang L, Yang H, Jia Y. Anti-cancer effects of nitazoxanide in epithelial ovarian cancer in-vitro and in-vivo. Chemico-Biol Interact. 2024;400:111176. [DOI] [PubMed] [Google Scholar]
- 21.Ledermann JA, Raja FA, Fotopoulou C, Gonzalez-Martin A, Colombo N, Sessa C. Newly diagnosed and relapsed epithelial ovarian carcinoma: ESMO Clinical Practice guidelines for diagnosis, treatment and follow-up. Annals Oncology: Official J Eur Soc Med Oncol. 2013;24(Suppl 6):vi24–32. [DOI] [PubMed] [Google Scholar]
- 22.Dogra N, Mukhopadhyay T. Impairment of the ubiquitin-proteasome pathway by methyl N-(6-phenylsulfanyl-1H-benzimidazol-2-yl)carbamate leads to a potent cytotoxic effect in tumor cells: a novel antiproliferative agent with a potential therapeutic implication. J Biol Chem. 2012;287(36):30625–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Shimomura I, Yokoi A, Kohama I, Kumazaki M, Tada Y, Tatsumi K, Ochiya T, Yamamoto Y. Drug library screen reveals benzimidazole derivatives as selective cytotoxic agents for KRAS-mutant lung cancer. Cancer Lett. 2019;451:11–22. [DOI] [PubMed] [Google Scholar]
- 24.Mrkvová Z, Uldrijan S, Pombinho A, Bartůněk P, Slaninová I. Benzimidazoles Downregulate Mdm2 and MdmX and activate p53 in MdmX Ove rexpressing Tumor cells. Molecules. 2019;24(11):2152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Park D, Lee JH, Yoon SP. Anti-cancer effects of fenbendazole on 5-fluorouracil-resistant colorectal cancer cells. Korean J Physiol Pharmacology: Official J Korean Physiological Soc Korean Soc Pharmacol. 2022;26(5):377–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Park D. Fenbendazole suppresses growth and induces apoptosis of actively growing H4IIE Hepatocellular Carcinoma cells via p21-Mediated cell-cycle arrest. Biol Pharm Bull. 2022;45(2):184–93. [DOI] [PubMed] [Google Scholar]
- 27.Carneiro BA, El-Deiry WS. Targeting apoptosis in cancer therapy. Nat Reviews Clin Oncol. 2020;17(7):395–417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yang B, Johnson TS, Thomas GL, Watson PF, Wagner B, Furness PN, El Nahas AM. A shift in the Bax/Bcl-2 balance may activate caspase-3 and modulate apoptosis in experimental glomerulonephritis. Kidney Int. 2002;62(4):1301–13. [DOI] [PubMed] [Google Scholar]
- 29.Yao W, Lin Z, Wang G, Li S, Chen B, Sui Y, Huang J, Liu Q, Shi P, Lin X, et al. Delicaflavone induces apoptosis via mitochondrial pathway accompanying G2/M cycle arrest and inhibition of MAPK signaling cascades in cervical cancer HeLa cells. Phytomedicine. 2019;62:152973–152973. [DOI] [PubMed] [Google Scholar]
- 30.Strasser A, Vaux DL. Cell death in the origin and treatment of Cancer. Mol Cell. 2020;78(6):1045–54. [DOI] [PubMed] [Google Scholar]
- 31.Jiang X, Li G, Zhu B, Zang J, Lan T, Jiang R, Wang B. p20BAP31 induces cell apoptosis via both AIF caspase-independent and the ROS/JNK mitochondrial pathway in colorectal cancer. Cell Mol Biol Lett. 2023;28(1):25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Samsuzzaman M, Jang B-C. Growth-suppressive and apoptosis-inducing effects of Tetrandrine in SW872 Human Malignant Liposarcoma cells via activation of Caspase-9, down-regulation of XIAP and STAT-3, and ER stress. Biomolecules. 2022;12(6):843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kim S, Perera SK, Choi SI, Rebhun RB, Seo KW. G2/M arrest and mitotic slippage induced by fenbendazole in canine melanoma cells. Veterinary Med Sci. 2022;8(3):966–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Čáňová K, Rozkydalová L, Vokurková D, Rudolf E. Flubendazole induces mitotic catastrophe and apoptosis in melanoma cells. Toxicol vitro: Int J Published Association BIBRA. 2018;46:313–22. [DOI] [PubMed] [Google Scholar]
- 35.Strausfeld U, Labbé JC, Fesquet D, Cavadore JC, Picard A, Sadhu K, Russell P, Dorée M. Dephosphorylation and activation of a p34cdc2/cyclin B complex in vitro by human CDC25 protein. Nature. 1991;351(6323):242–5. [DOI] [PubMed] [Google Scholar]
- 36.Malumbres M, Barbacid M. Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer. 2009;9(3):153–66. [DOI] [PubMed] [Google Scholar]
- 37.Stark GR, Taylor WR. Control of the G2/M transition. Mol Biotechnol. 2006;32(3):227–48. [DOI] [PubMed] [Google Scholar]
- 38.Fang Y, Yu H, Liang X, Xu J, Cai X. Chk1-induced CCNB1 overexpression promotes cell proliferation and tumor growth in human colorectal cancer. Cancer Biol Ther. 2014;15(9):1268–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Qiu L, Wang JJ, Ying SH, Feng MG. Wee1 and Cdc25 control morphogenesis, virulence and multistress tolerance of Beauveria bassiana by balancing cell cycle-required cyclin-dependent kinase 1 activity. Environ Microbiol. 2015;17(4):1119–33. [DOI] [PubMed] [Google Scholar]
- 40.Zhang X, Zhao J, Gao X, Pei D, Gao C. Anthelmintic drug albendazole arrests human gastric cancer cells at the mitotic phase and induces apoptosis. Experimental Therapeutic Med. 2017;13(2):595–603. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 41.Patel K, Doudican NA, Schiff PB, Orlow SJ. Albendazole sensitizes cancer cells to ionizing radiation. Radiation Oncol (London England). 2011;6:160. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated during the current study are available in the Gene Expression Omnibus, GSE275290.